How to use the cutadapt.seqio.open function in cutadapt

def test(self):
		expected = [
			(Sequence('read1/1 some text', 'TTATTTGTCTCCAGC', '##HHHHHHHHHHHHH'),
			Sequence('read1/2 other text', 'GCTGGAGACAAATAA', 'HHHHHHHHHHHHHHH')),
			(Sequence('read3/1', 'CCAACTTGATATTAATAACA', 'HHHHHHHHHHHHHHHHHHHH'),
			Sequence('read3/2', 'TGTTATTAATATCAAGTTGG', '#HHHHHHHHHHHHHHHHHHH')),
			(Sequence('read5', 'TTATTTGTCTCCAGC', '#####HHHHHHHHHH'),
			Sequence('read5', 'CAACAGGCCACATTAGACATATCGGATGGT', 'HHHHHHHH##HHHHHHHHHHHHHHHHHHHH')),
		]
		reads = list(InterleavedSequenceReader("tests/cut/interleaved.fastq"))
		for (r1, r2), (e1, e2) in zip(reads, expected):
			print(r1, r2, e1, e2)

		assert reads == expected
		with openseq("tests/cut/interleaved.fastq", interleaved=True) as f:
			reads = list(f)
		assert reads == expected

def test_autodetect_fasta_format(self):
		path = os.path.join(self._tmpdir, 'tmp.fasta')
		with openseq(path, mode='w') as f:
			assert isinstance(f, FastaWriter)
			for seq in simple_fastq:
				f.write(seq)
		assert list(openseq(path)) == simple_fasta

def test_sequence_reader(self):
		# test the autodetection
		with openseq("tests/data/simple.fastq") as f:
			reads = list(f)
		assert reads == simple_fastq

		with openseq("tests/data/simple.fasta") as f:
			reads = list(f)
		assert reads == simple_fasta

		with open("tests/data/simple.fastq") as f:
			reads = list(openseq(f))
		assert reads == simple_fastq

		# make the name attribute unavailable
		f = StringIO(open("tests/data/simple.fastq").read())
		reads = list(openseq(f))
		assert reads == simple_fastq

		f = StringIO(open("tests/data/simple.fasta").read())
		reads = list(openseq(f))
		assert reads == simple_fasta

def test_sequence_reader(self):
		# test the autodetection
		with openseq("tests/data/simple.fastq") as f:
			reads = list(f)
		assert reads == simple_fastq

		with openseq("tests/data/simple.fasta") as f:
			reads = list(f)
		assert reads == simple_fasta

		with open("tests/data/simple.fastq") as f:
			reads = list(openseq(f))
		assert reads == simple_fastq

		# make the name attribute unavailable
		f = StringIO(open("tests/data/simple.fastq").read())
		reads = list(openseq(f))
		assert reads == simple_fastq

def test_fastq_qualities_missing(self):
		path = os.path.join(self._tmpdir, 'tmp.fastq')
		openseq(path, mode='w', qualities=False)

def test_context_manager(self):
		filename = "tests/data/simple.fastq"
		with open(filename) as f:
			assert not f.closed
			reads = list(openseq(f))
			assert not f.closed
		assert f.closed

		with FastqReader(filename) as sr:
			tmp_sr = sr
			assert not sr._file.closed
			reads = list(sr)
			assert not sr._file.closed
		assert tmp_sr._file is None

def test_sequence_reader(self):
		# test the autodetection
		with openseq("tests/data/simple.fastq") as f:
			reads = list(f)
		assert reads == simple_fastq

		with openseq("tests/data/simple.fasta") as f:
			reads = list(f)
		assert reads == simple_fasta

		with open("tests/data/simple.fastq") as f:
			reads = list(openseq(f))
		assert reads == simple_fastq

		# make the name attribute unavailable
		f = StringIO(open("tests/data/simple.fastq").read())
		reads = list(openseq(f))
		assert reads == simple_fastq

		f = StringIO(open("tests/data/simple.fasta").read())
		reads = list(openseq(f))
		assert reads == simple_fasta

def test_autodetect_fasta_format(self):
		path = os.path.join(self._tmpdir, 'tmp.fasta')
		with openseq(path, mode='w') as f:
			assert isinstance(f, FastaWriter)
			for seq in simple_fastq:
				f.write(seq)
		assert list(openseq(path)) == simple_fasta

def test_write_qualities_to_fasta(self):
		path = os.path.join(self._tmpdir, 'tmp.fasta')
		with openseq(path, mode='w', qualities=True) as f:
			assert isinstance(f, FastaWriter)
			for seq in simple_fastq:
				f.write(seq)
		assert list(openseq(path)) == simple_fasta

def test_autodetect_fastq_format(self):
		path = os.path.join(self._tmpdir, 'tmp.fastq')
		with openseq(path, mode='w') as f:
			assert isinstance(f, FastqWriter)
			for seq in simple_fastq:
				f.write(seq)
		assert list(openseq(path)) == simple_fastq