How to use the cutadapt.seqio.Sequence function in cutadapt

To help you get started, we’ve selected a few cutadapt examples, based on popular ways it is used in public projects.

Secure your code as it's written. Use Snyk Code to scan source code in minutes - no build needed - and fix issues immediately.

github marcelm / cutadapt / tests / test_seqio.py View on Github external
import shutil
from textwrap import dedent
import pytest
from nose.tools import raises
from tempfile import mkdtemp
from cutadapt.seqio import (Sequence, FormatError,
	FastaReader, FastqReader, InterleavedSequenceReader,
	FastaWriter, FastqWriter, InterleavedSequenceWriter, open as openseq,
	sequence_names_match, find_fastq_record_end,
	read_paired_chunks, read_chunks_from_file)
from cutadapt._seqio import two_fastq_heads  # re-exported


# files tests/data/simple.fast{q,a}
simple_fastq = [
	Sequence("first_sequence", "SEQUENCE1", ":6;;8<=:<"),
	Sequence("second_sequence", "SEQUENCE2", "83
github marcelm / cutadapt / tests / test_seqio.py View on Github external
def test(self):
		expected = [
			(Sequence('read1/1 some text', 'TTATTTGTCTCCAGC', '##HHHHHHHHHHHHH'),
			Sequence('read1/2 other text', 'GCTGGAGACAAATAA', 'HHHHHHHHHHHHHHH')),
			(Sequence('read3/1', 'CCAACTTGATATTAATAACA', 'HHHHHHHHHHHHHHHHHHHH'),
			Sequence('read3/2', 'TGTTATTAATATCAAGTTGG', '#HHHHHHHHHHHHHHHHHHH')),
			(Sequence('read5', 'TTATTTGTCTCCAGC', '#####HHHHHHHHHH'),
			Sequence('read5', 'CAACAGGCCACATTAGACATATCGGATGGT', 'HHHHHHHH##HHHHHHHHHHHHHHHHHHHH')),
		]
		reads = list(InterleavedSequenceReader("tests/cut/interleaved.fastq"))
		for (r1, r2), (e1, e2) in zip(reads, expected):
			print(r1, r2, e1, e2)

		assert reads == expected
		with openseq("tests/cut/interleaved.fastq", interleaved=True) as f:
			reads = list(f)
		assert reads == expected
github marcelm / cutadapt / tests / test_seqio.py View on Github external
def test(self):
		reads = [
			(Sequence('A/1 comment', 'TTA', '##H'),
			Sequence('A/2 comment', 'GCT', 'HH#')),
			(Sequence('B/1', 'CC', 'HH'),
			Sequence('B/2', 'TG', '#H'))
		]
		sio = StringIO()
		with InterleavedSequenceWriter(sio) as writer:
			for read1, read2 in reads:
				writer.write(read1, read2)
		assert sio.getvalue() == '@A/1 comment\nTTA\n+\n##H\n@A/2 comment\nGCT\n+\nHH#\n@B/1\nCC\n+\nHH\n@B/2\nTG\n+\n#H\n'
github marcelm / cutadapt / tests / test_seqio.py View on Github external
def test(self):
		reads = [
			(Sequence('A/1 comment', 'TTA', '##H'),
			Sequence('A/2 comment', 'GCT', 'HH#')),
			(Sequence('B/1', 'CC', 'HH'),
			Sequence('B/2', 'TG', '#H'))
		]
		sio = StringIO()
		with InterleavedSequenceWriter(sio) as writer:
			for read1, read2 in reads:
				writer.write(read1, read2)
		assert sio.getvalue() == '@A/1 comment\nTTA\n+\n##H\n@A/2 comment\nGCT\n+\nHH#\n@B/1\nCC\n+\nHH\n@B/2\nTG\n+\n#H\n'
github marcelm / cutadapt / tests / test_seqio.py View on Github external
def match(name1, name2):
			seq1 = Sequence(name1, 'ACGT')
			seq2 = Sequence(name2, 'AACC')
			return sequence_names_match(seq1, seq2)
github marcelm / cutadapt / tests / test_seqio.py View on Github external
def match(name1, name2):
			seq1 = Sequence(name1, 'ACGT')
			seq2 = Sequence(name2, 'AACC')
			return sequence_names_match(seq1, seq2)
github marcelm / cutadapt / tests / test_seqio.py View on Github external
def test_write_sequence_object(self):
		with FastaWriter(self.path) as fw:
			fw.write(Sequence("name", "CCATA"))
			fw.write(Sequence("name2", "HELLO"))
		assert fw._file.closed
		with open(self.path) as t:
			assert t.read() == '>name\nCCATA\n>name2\nHELLO\n'